- Case report
- Open Access
- Published:
New Delhi metallo-β-lactamase-1 among Escherichia coli strains isolated from leukemia patients in Iran: two case reports
Journal of Medical Case Reports volume 15, Article number: 567 (2021)
Abstract
Background
Escherichia coli has appeared as an important opportunistic pathogen responsible for nosocomial infections in patients with immunodeficiency, particularly in leukemia patients. New Delhi metallo-beta-lactamase is an enzyme originally found in Enterobacteriaceae.
Case presentation
In this study, 80 isolates of Escherichia coli and Klebsiella pneumoniae were collected over the course of 2 years from two medical centers in Tehran, Iran. Production of carbapenemase was detected in the isolates using modified Hodge test. New Delhi metallo-beta-lactamase-1 genes were detected by polymerase chain reaction amplification with specific primers. Two New Delhi metallo-beta-lactamase-1-producing Escherichia coli strains were isolated from two Iranian patients with leukemia. These two patients were 6 and 15 years old, one female and the other male, from two oncology centers in Iran. The isolates were resistant to carbapenems (imipenem, meropenem), and two isolates were positive for carbapenemase production by modified Hodge test.
Conclusions
The emergence of New Delhi metallo-beta-lactamase-1-producing Escherichia coli is a threat for leukemia patients in oncology and hematology departments. We conclude that the incidence of multidrug resistant pathogens has increased among patients with leukemia and is life threatening.
Introduction
The globally increasing prevalence of New Delhi metallo-β-lactamase-1 (NDM-1)-producing Enterobacteriaceae is a concerning phenomenon in immunocompromised patients. Previous results indicated that blaNDM-1 gene can be carried on incompatibility group N (IncN) plasmids of different sizes along with other resistance factors. blaNDM-1 can confer resistance to almost all the β-lactams. Thus, bacteria carrying NDM-1 gene are considered to be resistant to all antibiotic classes except colistin and ciprofloxacin. The gene was scarcely integrated into the chromosome. The sequencing of this gene suggests a new enzyme, unrelated to hitherto known metallo β-lactamases (MBLs). The most similar known type is Verona integron-encoded metallo-β-lactamase (VIM-1/VIM-2), sharing 32.4% resemblance [1]. Immunosuppressive, sepsis, and radiation therapy can be the differential diagnosis of exotic infection [2,3,4,5].
In a study conducted in China, the presence of this gene was first reported in a patient with leukemia, but it has mainly been reported in patients with neutropenia. Our study is the first report from Iran. The purpose of this study was to investigate the existence of NDM-1 gene as a risk factor for life-threatening infection in patients with leukemia.
Case presentation
In this study, 80 isolates of Escherichia coli and Klebsiella pneumoniae were collected from two medical centers in Tehran, Iran: the Hematology-Oncology Research Center, Dr. Shariati Hospital, and the Mahak Pediatric Oncology Center, between 2014 and 2015.
The bacteria were isolated and stored in Hamadan University of Medical Sciences. All the clinical specimens were quickly sent to the laboratory and analyzed for confirmatory test. Isolates were identified using standard microbiological and biochemical procedures [6]. In our previous study, antibiotic susceptibility of the isolates was tested by Kirby–Bauer disk diffusion method for imipenem, ceftazidime, ceftriaxone, cefotaxime, ciprofloxacin, levofloxacin, amikacin, ampicillin, and gentamicin (all from Mast, UK). Moreover, the combination disk method was employed to detect extended-spectrum β-lactamase (ESBL)-producing isolates, while the minimum inhibitory concentrations (MICs) of selected antimicrobials were determined by the broth microdilution method. The results were interpreted according to the Clinical Laboratory Standards Institute (CLSI) guidelines [7]. The carbapenem-resistant strains were investigated for carbapenemase production by modified Hodge test (MHT) according to the CLSI guidelines, in which E. coli ATCC25922 was used as the positive control [8]. Furthermore, the combined disk diffusion method was applied for blaMBL detection using two IPM (10 µg) disks and ethylenediaminetetraacetic acid (EDTA) 0.5 M solution[9]. For diagnosis of the NDM1, polymerase chain reaction (PCR) was performed on DNA extracted by boiling, using NDM-F-specific primers: CAACTGGATCAAGCAGGAGA, NDM-R TCGATCCCAACGGTGATATT (Bioneer Company, Korea) [10].
The sequencing of amplicons in both directions was carried out by the Bioneer Company (Daejeon, South Korea). The data were analyzed using FinchTV software (Geospiza, USA), and the sequences were then confirmed using the National Center for Biotechnology Information (NCBI) website (http://www.ncbi.nlm.nih.gov/ BLAST). A total of 56 E. coli and 24 K. pneumoniae isolates were obtained from urine, blood, sputum, wound, and vagina. Among the 80 isolates, 52 (63%) strains were ESBL producers, followed by 5 (6.25%) metallo β-lactamase (MBL) producers. According to our antimicrobial susceptibility test on E. coli and K. pneumoniae isolates, eight (10%) of E. coli isolates were imipenem-resistant. Out of 80 isolates, 8 (10%) isolates were found to be carbapenem-resistant. The major MBL and carbapenem-resistant species were E. coli. The first NDM-1-containing isolate was obtained from a 26-year-old subject diagnosed with acute leukemia. The second was obtained from a 2-year-old child with acute leukemia. These two NDM-1-positive E. coli isolates (labeled as E1–E2) were recovered from the urine and blood samples of two different hospitalized patients. Both isolates were positive for the modified Hodge test and MBL producers (Tables 1 and 2).
Discussion
The present study reports NDM-1-producing E. coli strain from the bloodstream and infected urinary tract of two patients. PCR results confirmed that the NDM-1-producing E. coli harbored qnrA, qnrB, qnrS and blaCTXM-1,CTX-M2,CTX-M8,CTX-M9,CTX-M25, and the insertion sequence of ISECP1,IS26,IS903. The two NDM-1-producing E. coli isolates did not contain qnrS genes, but they carried blaTEM gene.
Eyvazi et al. recently reported blaNDM-1-producing E. coli in Iran for the first time [11]. Shahcheraghi et al. detected the first blaNDM-1-producing K. pneumonia in Iran as well [12].
In October 2011, Laurent Poirel et al. reported blaNDM-1-producing K. pneumoniae and E. coli. in a 16-year-old male patient admitted to the hematology unit of a hospital in Istanbul, Turkey [13].
In a study in 2010 on a patient transferred from Iraq to France, NDM-1-producing K. pneumoniae was also reported [14].
Reports have also declared the existence of blaNDM-1-producing Enterobacteriaceae in Pakistan and Afghanistan [15, 16]. The blaNDM-1-producing bacteria could also be found in environmental samples and drinking water [17]. In our investigation, PCR confirmed that the NDM-1-producing E. coli harbored quinolone resistance gene B (qnrB) and blaCTXM-9. This result was similar to the other reports on strains carrying blaNDM-1 that also harbored other β-lactamase genes [18].
An NDM-1-producing E. coli strain was detected in the bloodstream of a patient in this study that exhibited high resistance to all tested β-lactam antibiotics, which can be attributed to the production of blaNDM-1 and other resistant genes.
Bahramian et al. published the first report about metallo-β-lactamase-6 (NDM-6) among K. pneumoniae in New Delhi. ST147 strains were also isolated from dialysis patients in Iran [19]. Firoozeh et al. reported 20 (11.1%) K. pneumoniae isolates harboring blaNDM-1 gene (20).
We inferred that it is important to evaluate the health condition of immunocompromised patients, especially those with leukemia. Moreover, patients receiving chemotherapy may develop bloodstream infections. Bacterial infections can result in significant morbidity and mortality due to the development of febrile neutropenia and bacteremia.
Conclusion
This is the first report on the blaNDM-1-producing E. coli strains isolated from leukemia patients in Iran. NDM-1-producing E. coli also harbored genes encoding cefotaxime-resistant (CTX-M) group, TEM, quinolone resistance (QNR), and insertion sequence of resistance enzymes. The coincidence of NDM-1 with other antibiotic-resistance genes may further limit the treatment options and makes infection control procedures more challenging among leukemia patients. Our results show the emergence of blaNDM-1 as an alarm to our health services, particularly among immunocompromised patients.
Availability of data and materials
The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.
Abbreviations
- NDM-1:
-
New Delhi metallo-β-lactamase-1
- ESBL:
-
Extended spectrum β-lactamase
- MIC:
-
Minimum inhibitory concentration
- MBL:
-
Metallo-β-lactamase
- VIM:
-
Verona integron-encoded metallo-β-lactamase
- Qnr:
-
Quinolone resistance
- bla:
-
Beta lactamase
References
Yong D, Toleman MA, Giske CG, Cho HS, Sundman K, Lee K, et al. Characterization of a new metallo-β-lactamase gene, blaNDM-1, and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence type 14 from India. Antimicrob Agents Chemother. 2009;53(12):5046–54.
Devaraj NK. Antibiotic resistance: a real menace. Oman Med J. 2017;32(6):531.
Devaraj NK, Aneesa A, Abdul Hadi A, Shaira N. Topical corticosteroids in clinical practice. Med J Malaysia. 2019;74(2):187–9.
Devaraj NK. A recurrent cutaneous eruption. BMJ Case Rep. 2019. https://doi.org/10.1136/bcr-2018-228355.
Devaraj NK, Suppiah S, Veettil SK, Ching SM, Lee KW, Menon RK, et al. The effects of probiotic supplementation on the incidence of diarrhea in cancer patients receiving radiation therapy: a systematic review with meta-analysis and trial sequential analysis of randomized controlled trials. Nutrients. 2019;11(12):2886.
Forbes BA, Sahm DF, Weissfeld AS, Bailey WR. Bailey & Scott’s diagnostic microbiology. St. Louis, Mo: Elsevier Mosby; 2007.
Patel JB, Cockerill F, Bradford PA. Performance standards for antimicrobial susceptibility testing: twenty-fifth informational supplement. 2015; 35(1).
Lee K, Chong Y, Shin H, Kim Y, Yong D, Yum J. Modified Hodge and EDTA-disk synergy tests to screen metallo-β-lactamase-producing strains of Pseudomonas and Acinetobacter species. Clin Microbiol Infect. 2001;7(2):88–91.
Yong D, Lee K, Yum JH, Shin HB, Rossolini GM, Chong Y. Imipenem-EDTA disk method for differentiation of metallo-β-lactamase-producing clinical isolates of Pseudomonas spp. and Acinetobacter spp. J Clin Microbiol. 2002;40(10):3798–801.
Teo J, Ngan G, Balm M, Jureen R, Krishnan P, Lin R. Molecular characterization of NDM-1 producing Enterobacteriaceae isolates in Singapore hospitals. WPSAR. 2012;3(1):19.
Eyvazi S, Hakemi-Vala M, Hashemi A, BagheriBejestani F, Elahi N. Emergence of NDM-1-producing Escherichia coli in Iran. Arch Clin Infect Dis. 2017. https://doi.org/10.5812/archcid.62029.
Shahcheraghi F, Nobari S, Rahmati Ghezelgeh F, Nasiri S, Owlia P, Nikbin VS, et al. First report of New Delhi metallo-beta-lactamase-1-producing Klebsiella pneumoniae in Iran. Microb Drug Resist. 2013;19(1):30–6.
Poirel L, Özdamar M, Ocampo-Sosa AA, Türkoglu S, Ozer UG, Nordmann P. NDM-1-producing Klebsiella pneumoniae now in Turkey. Antimicrob Agents Chemother. 2012;56(5):2784–5.
Poirel L, Fortineau N, Nordmann P. International transfer of NDM-1-producing Klebsiella pneumoniae from Iraq to France. Antimicrob Agents Chemother. 2011;55(4):1821–2.
Kumarasamy KK, Toleman MA, Walsh TR, Bagaria J, Butt F, Balakrishnan R, et al. Emergence of a new antibiotic resistance mechanism in India, Pakistan, and the UK: a molecular, biological, and epidemiological study. Lancet Infect Dis. 2010;10(9):597–602.
Mc Gann P, Hang J, Clifford RJ, Yang Y, Kwak YI, Kuschner RA, et al. Complete sequence of a novel 178-kilobase plasmid carrying blaNDM-1 in a Providencia stuartii strain isolated in Afghanistan. Antimicrob Agents Chemother. 2012;56(4):1673–9.
Walsh TR, Weeks J, Livermore DM, Toleman MA. Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect Dis. 2011;11(5):355–62.
Zhang X, Du J, Zhou C, Cao J, Lu H, Liu H, et al. An uncommon ST1224 NDM-1-producing Klebsiella pneumoniae isolated from the bloodstream of a leukemia patient in China. Chemotherapy. 2017;62(4):262–8.
Bahramian A, Shariati A, Azimi T, Sharahi JY, Bostanghadiri N, Gachkar L, et al. First report of New Delhi metallo-β-lactamase-6 (NDM-6) among Klebsiella pneumoniae ST147 strains isolated from dialysis patients in Iran. Infect Genet Evol. 2019;69:142–5.
Firoozeh F, Mahluji Z, Shams E, Khorshidi A, Zibaei M. New Delhi metallo-β-lactamase-1-producing Klebsiella pneumoniae isolates in hospitalized patients in Kashan Iran. Iran J Microbiol. 2017;9(5):283.
Acknowledgements
The authors of this article are grateful to Hamadan University of Medical Sciences for their financial support in conducting the research.
Funding
This article was conducted on financial support of vice-chancellor for research of Hamadan University of Medical Sciences (project number 980203554).
Author information
Authors and Affiliations
Contributions
MR, FA, and SD performed microbiological and molecular tests and wrote the manuscript. AG, AH, and HG played a role in project administration. MRA supervised all of the stages of designing the study, conducting the research, and writing the manuscript. All authors read and approved the final manuscript.
Corresponding author
Ethics declarations
Ethics approval and consent to participate
This study was approved by the Ethics Committee of Hamadan University of Medical Sciences (code no. IR.UMSHA.REC.1398.004).
Consent for publication
Written informed consent was obtained from the patients” legal guardian for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.
Competing interests
The authors declare that they have no competing interests
Additional information
Publisher’s Note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Rights and permissions
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.
About this article
Cite this article
Roshani, M., Goodarzi, A., Dehbashi, S. et al. New Delhi metallo-β-lactamase-1 among Escherichia coli strains isolated from leukemia patients in Iran: two case reports. J Med Case Reports 15, 567 (2021). https://doi.org/10.1186/s13256-021-03160-2
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/s13256-021-03160-2
Keywords
- bla NDM-1
- Escherichia coli
- Klebsiella pneumoniae
- Leukemia