Skip to main content

Table 2 Sequence of primers used in this study

From: Cystinosis and two rare mutations in CTNS gene: two case reports

Primer name Primer sequence Primer name Primer sequence
Ex3F GGTGGCAGTCCTTTATGAGC Ex3R AAACCCTTGGCAACAAACAG
Ex4F AGGGCTCGTCAGAGAGTCAG Ex4R CTTTGCGATCCCATCCTG
Ex5F CGATTTCCACCTGGCTACC Ex5R TGATACTCATCCCCAAAAGACAC
Ex6-7F GAGGTTCAAGTTGGCTGGTG Ex6-7R TGGAAAGGGTAGGCAGACAG
Ex8-9F AGGAAGGGAGGAGGGAAGTAG Ex8-9R ACCTGGATGAATGAACACACAC
Ex10F CTCTCTAAGCCCGCCCTATC Ex10R TTTCCGTCCTGTTTCCTCAC
Ex11F ACCACCCAAACTGTTCCTTG Ex11R GAAAACCACAAAGCCTCCAG
Ex12-13F CTGGAGGCTTTGTGGTTTTC Ex12-13R AGAGAGGGCAGAAGAGAGTAAGC