Skip to main content

Advertisement

Table 2 Polymerase chain reaction and sequencing primers of RET gene

From: Association of medullary sponge kidney and hyperparathyroidism with RET G691S/S904S polymorphism: a case report

Exon Sense primer PCR product (base pairs) T (°C)
RET-1 5′- GCACCCGCCATCCAGACC -3′ 567 62
RET-1 5′- TCTCCTGCCGAAACAGAACTC -3′   
RET-2 5′- CGGCTTGGATGATTGAGAATAGG-3′ 583 58
RET-2 5′- GTGATAAGGGCGGCTTGAGG-3′   
RET-3 5’-TCCTCCCCATTCCCGACTG − 3′ 573 56
RET-3 5′- AGGCAGGCAAGATTCCAACC-3’   
RET-4 5’-CAACCAGCACGAGTGAGGAC -3’ 640 60
RET-4 5’-ACGGAGGCGAAGGACAAATG −3’   
RET-5 5’-AACACACATCTGGTCCACCTATG − 3’ 375 56
RET-5 5′- AAGAGCGAGCACCTCATTTCC-3’   
RET-6 5’-GTGTGAAAGTGCGTGTTTGC -3’ 428 60
RET-6 5’-CAGTCTACTCTGTGCTGGTTG −3’   
RET-7 5′- GGACTTAGGCTGTGTGGGAATC-3’ 516 58
RET-7 5′- -CTGGAAGGAGCAACCATTTACTG-3’   
RET-8 5’-GCTGGTGCTGTTCCCTGTC -3’ 375 62
RET-8 5’-CACTGCTGCCCGCTATGC -3’   
RET-9 5’-CCTCCAGTTGCTCCTCCCTAG −3’ 470 58
RET-9 5′- CTGCTTCTGAAATCTGTGTGTGC-3’   
RET-10 5’-GGCAGAGTCCTTTGTTCAGATG −3’ 452 58
RET-10 5′- CAGCAATTTCCTCCCTTGTTGG-3’   
RET-11 5’-GAGCCTCTGTCTCCATCTGTAAG −3’ 606 56
RET-11 5’-CTCGTCTGCCCAGCGTTG −3   
RET-12 5’ GCAGAGACAGGCAGCGTTG--3’ 499 58
RET-12 5′- CCTTCCAGGGAGAGCAAAGTC-3’   
RET-13 5′- AGAAGCCTCAAGCAGCATCG-3’ 432 58
RET-13 5’-TCAGCCCGTGGACTCAGC-3’   
RET-14 5′- GGCAGAGAGCAAGTGGTTCAAG-3’ 618 60
RET-14 5′- GGGCGTGGTGGAGTCAGG-3’   
RET-15 5′- CCACACACCACCCCTCTG-3’ 401 58
RET-15 5’-GGCTGAGCGGAGTTCTAATTG −3’   
RET-16 5’-CACTCCTCTGGTTACTGAAAGC -3’ 370 56
RET-16 5′- CATTTGCCTCACGAACACATC-3’   
RET-17 5′- CCAGACCCAGGCTGACATC-3’ 449 60
RET-17 5′- ATCTACTGCCACACCCAAGG-3’   
RET-18 5′- AGGGTGCGATGGCTGTGG-3’ 352 58
RET-18 5′- AGGGTTCAATCTGCTGTCTGC-3’   
RET-19 5’-CTTGGAGAGGTCAGGAGATTGG −3’ 453 58
RET-19 5’-AATGCCTAAATGTAAACTGGATGC -3’   
RET-20 5′- TTGGAAACCTGGAACACAAAACC-3’ 430 62
RET-20 5′- GCCACCTGGGAACTGAACAC-3’   
  1. PCR polymerase chain reaction, RET rearranged during transfection, T annealing temperature for the PCR reactions