Skip to main content

Table 4 Sequence of oligonucleotides for each exon, with the annealing temperatures (T°A) and the length in base pair (bp) of the amplified product

From: Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study

Exon Sequence of primers T°A bp
1 GAGAAAGCCGCTAGAGCAAA(CF1F) 55°C 394
TCCTTTACCCCAAACCCAAC(CF1R)
2 TCCAAATCTGTATGGAGACCA(CF2F) 55°C 603
TCAGTGTGAAAATGAGATGTTCC(CF2R)
3 TCTGGCTGAGTGTTTGGTGT(CF3F) 55°C 399
TTTGGAGTTGGATTCATCCTTT(CF3R)
4 AAACTTGTCTCCCACTGTTGC(CF4F) 55°C 453
GGCCTGTGCAAGGAAGTATT(CF4R)
5 GTGCCTAGATGCTGGGAAAT(CF5F) 55°C 393
AAAACTCCGCCTTTCCAGTT(CF5R)
6a TGCTATGTGCTCCATGTAATGA(CF6AF) 55°C 415
TGCATAGAGCAGTCCTGGTT(CF6AR)
6b TGCCCATCTGTTGAATAAAAG(CF6BF) 55°C 411
CCCATGAAAGTGAATTTGTGC(CF6BR)
7 TTCCATTCCAAGATCCCTGA(CF7F) 55°C 404
GCACATTTTTGCAAAGTTCA(CF7F)
8 GAATCCTAGTGCTTGGCAAAT(CF8F) 55°C 404
GATCCTCCTTCCAGTTCTACCA(CF8R)
9 GGCCATGTGCTTTTCAAACT(CF9F) 55°C 389
CTCCAAAAATACCTTCCAGCA(CF9R)
10 TGAATCCTGAGCGTGATTTG(CF10F) 55°C 435
TTCATGTGTTTGCAAGCTTCTT(CF10R)
11 GAAGGAAGATGTGCCTTTCAA(CF11F) 55°C 395
CCAAGATACGGGCACAGATT(CF11R)
12 TCAGTGAATCGATGTGGTGAC(CF12F) 55°C 419
ATGAGGCGGTGAGAAAAGGT(CF12R)
13-1 TCATGCTATCAGAATTCACAAGG(CF13F1) 56°C 575
GGGAGTCTTTTGCACAATGG(CF13R1)
13-2 CTGGAGAGTTTGGGGAAAAA(CF13F2) 56°C 449
AAATACCCCCAAGCGATGTA(CF13R2)
14a CAATGGTGGCATGAACTGT(CF14AF) 55°C 437
GTGGTTCTACTTGTTGATTTTTCAG(CF14AR)
14b TGGCTTTCTTGTGAGGTTCA(CF4BF) 55°C 446
TGCTTGGGAGAAATGAAACA(CF14BR)
15 GTCGCCAAATAACGATTTCC(CF15F) 55°C 406
AGGTTCAACAAAGGGCACAT(CF15R)
16 TTTGGGTTCTGAATGCGTCT(CF16F) 55°C 388
GGCCAGGTAAGCAGTTCTGA(CF16R)
17a CTCACCAACATGTTTTCTTTGA(CF17AF) 55°C 399
CCAAAATGAAGTCACATGGTCA(CF17AR)
17b GAATGGCACCAGTGTGAAAA(CF17BF) 55°C 682
CAATCTGTGTGCATCGGTTT(CF17BR)
18 TGTGCCCTAGGAGAAGTGTG(CF18F) 55°C 335
TGACAGATACACAGTGACCCTCA(CF18R)
19 GCCCGACAAATAACCAAGTG(CF19F) 55°C 399
GCAAGCAGTGTTCAAATCTCA(CF19R)
20 CCAATTCCTTATGCCCAGTT(CF20F) 55°C 408
TGGCTAAGTCCTTTTGCTCA(CF20R)
21 TGATGGTAAGTACATGGGTGTTTC(CF21F) 57°C 578
GGAGCCATACCAGTGAGGAG(CF21R)
22 TCAAATGGTGGCAGGTAGTG(CF22F) 55°C 382
TCACCATGAAGCAGGCATAA(CF22R)
23 CCCATGGTTGAAAAGCTGAT(CF23F) 55°C 417
TGAGTAAAGCTGGATGGCTG(CF23R)
24 GCCTTCTGTCCCAGATCTCA(CF24F) 60°C 362
GAGCAAATGTCCCATGTCAA(CF24R)