Skip to main content

Table 2 Sequences of primers used for alternate polymerase chain reactions

From: An antiretroviral drug-naïve human immunodeficiency virus-1 infected woman with a persistent non-reactive proviral deoxyribonucleic acid polymerase chain reaction: a case report

Genome region Primer name Sequence (5´ to 3´) Reference
Group M pol    
Protease (RT PCR) Outer sense : 5´Prot1 TAATTTTTTAGGGAAGATCTGGCCTTCC Ref. 8
Outer antisense : 3´Prot1 GCAAATACTGGAGTATTGTATGGATTTTCAGG Ref. 8
(nested PCR) Inner sense : 5´Prot2 TCAGAGCAGACCAGAGCCAACAGCCCCA Ref. 8
Inner antisense : 3´Prot2 AATGCTTTTATTTTTTCTTCTGTCAATGGC Ref. 8
Reverse transcriptase (RT PCR) Outer sense : MJ3 AGTAGGACCTACACCTGTCA Ref. 8
Outer antisense : MJ4 CTGTTAGTGCTTTGGTTCCTCT Ref. 8
(nested PCR) Inner sense : A35 TTGGTTGCACTTTAAATTTTCCCATTAGTCCTATT Ref. 8
Inner antisense : NE135 CCTACTAACTTCTGTATGTCATTGACAGTCCAGCT Ref. 8
Group M env    
Gp41 (RT PCR) Outer sense : 1S TGGAGGAGGAGATATGAGG  
Outer antisense : AS1 GTGAGTATCCCTGCCTAACTCTAT Ref. 9
(nested PCR) Inner sense : T20S1 GAGGGACAATTGGAGAAGTGAATT Ref. 9
Inner antisense : 2AS CTACCAAGCCTCCTACTATC Ref. 9
Group O pol    
Pol (RT PCR) Outer sense : ProtO TTCAAYTGTGGRAAAGAGGGAC Ref. 3
Outer antisense : PolOL1 CTAATTCCTTGATAGATTTGACT Ref. 3
*Protease (nested PCR) Inner sense : Prot4 CAGCCCCACCRATGGAGG Ref. 3
Inner antisense : NouvL CATTGTTTTACTTTTGGTCCAT Ref. 3
*Reverse transcriptase (nested PCR) Inner sense : PolOF1 CAGTATTRGTGGGACCTACTCCTGTT Ref. 3
Inner antisense : PolOL2 GGCTGTACTGTCCAYTTGTCTG Ref. 3
Group O env    
Gp41 (RT PCR) Outer sense : V3DURA ATTCCAATACACTATTGTGCTCCA Ref. 3
Outer antisense : gp41NE3 TAAGTTGCTCAAGAGGTGGTA Ref. 3
(nested PCR) Inner sense : OFU TAAAACCTTTTAGTGTRGCAC Ref. 3
Inner antisense : 8393L GTTGATATCCCTGCCTAATG Ref. 3
Group O and M-specific PCR (integrase region) Outer sense : 4235 CCCTACAATCCCCAAAGTCAAGG Ref. 7
Outer antisense : 4538 TACTGCCCCTTCACCTTTCCA Ref. 7
(nested PCR) Inner sense : 4327 TAAGACAGCAGTACAAATGGCAG Ref. 7
Inner antisense : 4481 GCTGTCCCTGTAATAAACCCG Ref. 7
  1. PCR polymerase chain reaction, Ref. Reference, RT reverse transcriptase, * use the same RT PCR primers from the pol gene.